LOC796490

Ensembl ID:
ENSDARG00000038139
Human Orthologue:
PDGFB
Human Description:
platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) [Sou
Mouse Orthologue:
Pdgfb
Mouse Description:
platelet derived growth factor, B polypeptide Gene [Source:MGI Symbol;Acc:MGI:97528]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38385 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055607 Nonsense 223 482 5 7
Genomic Location (Zv9):
Chromosome 3 (position 24581052)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24159263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAACACAACCAGAGGCTAAACCTGGAGGACCTGCTCAGCCACAGCTG[G/A]CTGCCCCAAGACAGGTTCTCTGAATCACCAGACACTGTCCATTTTGGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link