si:ch211-13k12.2

Ensembl ID:
ENSDARG00000038121
ZFIN ID:
ZDB-GENE-061207-5
Description:
Novel protein similar to elongation factor RNA polymerase II (Ell) [Source:UniProtKB/TrEMBL;Acc:A2BI
Human Orthologues:
ELL, ELL2
Human Descriptions:
elongation factor RNA polymerase II [Source:HGNC Symbol;Acc:23114]
elongation factor, RNA polymerase II, 2 [Source:HGNC Symbol;Acc:17064]
Mouse Orthologues:
Ell, Ell2
Mouse Descriptions:
elongation factor RNA polymerase II 2 Gene [Source:MGI Symbol;Acc:MGI:2183438]
elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099511 Nonsense 43 593 1 12
ENSDART00000133029   None 187 None 5
ENSDART00000135874 Nonsense 43 308 1 7

The following transcripts of ENSDARG00000038121 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 25429249)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25659022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCACGTCAAACTAACCGACACGGCCATCCGGACGCKGGAAGCCTAT[C/T]AGAATCTTAAGGTAATGCGTTTTGCTTCGATTTCRCCACTGTTCATTTRC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link