gnrhr4

Ensembl ID:
ENSDARG00000038116
ZFIN ID:
ZDB-GENE-050419-76
Description:
gonadotropin releasing hormone receptor 4 [Source:RefSeq peptide;Acc:NP_001091663]
Human Orthologue:
GNRHR
Human Description:
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055567 Nonsense 330 406 3 3
Genomic Location:
Chromosome 18 (position 25175097)
KASP Assay ID:
554-0236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGTTTATTTTTGGACTGTTTAATGCAATCCTGGATCCCATCACTTA[C/A]GGCCTCTTCACCATCCACTTTCGCAAAGGACTGAAGCGCTACTGTCGCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/akdqa9db