xpa

Ensembl ID:
ENSDARG00000038114
ZFIN ID:
ZDB-GENE-040426-1205
Description:
xeroderma pigmentosum, complementation group A [Source:RefSeq peptide;Acc:NP_956765]
Human Orthologue:
XPA
Human Description:
xeroderma pigmentosum, complementation group A [Source:HGNC Symbol;Acc:12814]
Mouse Orthologue:
Xpa
Mouse Description:
xeroderma pigmentosum, complementation group A Gene [Source:MGI Symbol;Acc:MGI:99135]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16787 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055566 Essential Splice Site 59 549 2 9

The following transcripts of ENSDARG00000038114 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 11220514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCTCAGACAAGCCAGACTYGCCAGCAGAMCGTCCTCCGCYGTAGAAG[G/A]TCTGACTTTTGTTTAAAACCTRCACAAGACATGTACAAATTTAATTTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/niw0893s