LOC100004951

Ensembl ID:
ENSDARG00000038111

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8911 Nonsense Mutation detected in F1 DNA During 2014
sa10056 Nonsense Available for shipment Available now
sa5269 Nonsense Mutation detected in F1 DNA During 2014
sa1263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055562 Nonsense 233 506 2 2
ENSDART00000055562 Nonsense 233 506 2 2
Genomic Location:
Chromosome 4 (position 58283419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCSCTGGATAYATACCAGAAGCTGCCCACACTGCTGAAGGAGAATCCC[C/T]AGAATGCAGTTCCAATWAAAGYCTGRCTRTATMCCCTTCATCTACTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055562 Nonsense 233 506 2 2
ENSDART00000055562 Nonsense 233 506 2 2
Genomic Location:
Chromosome 4 (position 58283419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCSCTGGATAYATACCAGAAGCTGCCCACACTGCTGAAGGAGAATCCC[C/T]AGAATGCAGTTCCAATWAAAGYCTGRCTRTATMCCCTTCATCTACTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055562 Nonsense 241 506 2 2
Genomic Location:
Chromosome 4 (position 58283393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACACTGCTGAAGGAGAATCCCCAGAATGCAGTTCCAATTAAAGTCTG[G/A]CTRTATCCCCTTCATCTACTAAATGATAACGTAGCCAAGCTGGAGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055562 Nonsense 506 506 2 2
Genomic Location:
Chromosome 4 (position 58282600)
KASP Assay ID:
554-1178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTATGAAAAAGGAGAACTGAAAGACACAAAGTTCCAGTTGCCATCC[A/T]AACCGCCTCCACCAATAGTGAAGGATGTCCAGGACAAAACTGTGTCCCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wvs68kc8