sgcg

Ensembl ID:
ENSDARG00000038107
ZFIN ID:
ZDB-GENE-030724-2
Description:
sarcoglycan, gamma (sgcg), mRNA [Source:RefSeq DNA;Acc:NM_001003748]
Human Orthologue:
SGCG
Human Description:
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) [Source:HGNC Symbol;Acc:10809]
Mouse Orthologue:
Sgcg
Mouse Description:
sarcoglycan, gamma (dystrophin-associated glycoprotein) Gene [Source:MGI Symbol;Acc:MGI:1346524]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28409 Nonsense Mutation detected in F1 DNA During 2017
sa42495 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055555 Nonsense 70 292 3 10
ENSDART00000144381 Nonsense 70 292 3 8
Genomic Location (Zv9):
Chromosome 15 (position 9473645)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9356407
KASP Assay ID:
2260-8177.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAAATGCACTATTGGTGGTATTATTTTTGTAGGAAGGCATGGGGTA[C/A]TTGCAAGTCCACGAAGATGGACTAAGACTAGAGGGAGAGTCAGACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055555 Nonsense 265 292 8 10
ENSDART00000144381 Nonsense 265 292 8 8
Genomic Location (Zv9):
Chromosome 15 (position 9488154)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9370916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGAGAAGCCGGAACTTCAGGAGACTCTCAGGGAATGTACAACATGTA[T/A]GAGGTTTGCGTTTGCCCCAGTGGGAAACTCTTTTTCTCCACGGCCGGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association of bipolar disorder suggests an enrichment of replicable associations in regions near genes. (View Study)
  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Type 2 diabetes: Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link