pigq

Ensembl ID:
ENSDARG00000038097
ZFIN ID:
ZDB-GENE-030131-9793
Description:
phosphatidylinositol N-acetylglucosaminyltransferase subunit Q [Source:RefSeq peptide;Acc:NP_955461
Human Orthologue:
PIGQ
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class Q [Source:HGNC Symbol;Acc:14135]
Mouse Orthologue:
Pigq
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class Q Gene [Source:MGI Symbol;Acc:MGI:1333114]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20015 Nonsense Available for shipment Available now
sa9661 Nonsense Available for shipment Available now
sa16321 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055539 Nonsense 94 584 1 10
ENSDART00000143710 Nonsense 94 584 2 11
Genomic Location (Zv9):
Chromosome 3 (position 26212712)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26674260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTTCCTCAAAGACCTGAGCACCATCTTTCCTCAGAAATGTTGGCTG[C/T]AGTTGAGCCGTGAGATTGGCAAAAGAGGCTTTACATGTCGGGTGGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055539 Nonsense 443 584 6 10
ENSDART00000143710 Nonsense 443 584 7 11
Genomic Location (Zv9):
Chromosome 3 (position 26219141)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26667831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAGAGRAAAGAAATGGAACGTTTTGAGGCAGAGGGTGGACTCGTGCT[C/A]WTACGACCTGGACCAGGTACGTCTCAGCATGATTTATTCATSTATTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055539 Essential Splice Site 475 584 7 10
ENSDART00000143710 Essential Splice Site 475 584 8 11
Genomic Location (Zv9):
Chromosome 3 (position 26219321)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26667651
KASP Assay ID:
2259-3472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTCCTGCTGCCCACCACTGCCCTCTATTACCTGGTCTTTACCCTGG[T/A]GAGTCACTCCAACATAAACTTMAATCTCATCACTATTCCAGCAGAGCTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link