ergic3

Ensembl ID:
ENSDARG00000038074
ZFIN ID:
ZDB-GENE-040426-795
Description:
Endoplasmic reticulum-Golgi intermediate compartment protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q803
Human Orthologue:
ERGIC3
Human Description:
ERGIC and golgi 3 [Source:HGNC Symbol;Acc:15927]
Mouse Orthologue:
Ergic3
Mouse Description:
ERGIC and golgi 3 Gene [Source:MGI Symbol;Acc:MGI:1913616]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31542 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055502 Essential Splice Site 29 383 1 13
ENSDART00000055511 Essential Splice Site 29 388 1 14
Genomic Location (Zv9):
Chromosome 6 (position 50344532)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50394010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGAAAACTCTAGAGGACTTCAGGATCAAAACATGTGGAGGAGCCACGG[G/T]TGAGTGACAAAAATCCACCGGGAGCTGTACAAGTGTTGAGCGCCATTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link