PTX4

Ensembl ID:
ENSDARG00000038072
Description:
pentraxin 4, long [Source:HGNC Symbol;Acc:14171]
Human Orthologue:
PTX4
Human Description:
pentraxin 4, long [Source:HGNC Symbol;Acc:14171]
Mouse Orthologue:
Ptx4
Mouse Description:
pentraxin 4 Gene [Source:MGI Symbol;Acc:MGI:1915759]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33182 Nonsense Available for shipment Available now
sa13504 Nonsense Available for shipment Available now
sa17410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055500 Nonsense 200 476 5 6
Genomic Location (Zv9):
Chromosome 3 (position 27810442)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27528481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATTCTATTAGGAAGCAACATGGAGTGCTCATGAGGCATGTTCAGACT[C/T]AACCAAAGTCCAGAGAGCACAGAATAAGAGAGAGGTTGTTGTTGAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055500 Nonsense 249 476 5 6
Genomic Location (Zv9):
Chromosome 3 (position 27810589)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27528628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACAACCRAMAGTTCAGGCTCACGAGGAACTTTTTCAACTTCCACTT[C/T]GACACAAAATCCCACAYRTTCAAAGYCCAAAGGAAGAAGCCARAAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055500 Nonsense 306 476 6 6
Genomic Location (Zv9):
Chromosome 3 (position 27813561)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27531600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGGAATACATGAGCTCTCTATTTGCACTTGGCTYAAAGTAGACGCC[A/T]ARTATGTTGGAACAATTTTTTCTTACGCCACGGAAAACAACGACAATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link