mgat3

Ensembl ID:
ENSDARG00000038069
ZFIN ID:
ZDB-GENE-050522-249
Description:
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:RefSeq peptide;A
Human Orthologue:
MGAT3
Human Description:
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Mouse Orthologue:
Mgat3
Mouse Description:
mannoside acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:104532]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40063 Nonsense Mutation detected in F1 DNA During 2017
sa40062 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055493 Nonsense 339 493 3 3
ENSDART00000139423 Nonsense 348 502 3 3
Genomic Location (Zv9):
Chromosome 3 (position 25339593)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25107778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGAACCGGTCGGGATCCATTTGCGTAAATCCTTATATGGGTTTTTCT[G/A]GAGACAGTATGGAACGCTTAACGTCTTATCCGCTTGCACGGCAGCTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055493 Nonsense 440 493 3 3
ENSDART00000139423 Nonsense 449 502 3 3
Genomic Location (Zv9):
Chromosome 3 (position 25339289)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25107474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACTTTCCACGTTGGGGGGATTATGGGGAGAAACGGAAGTTAAGTTA[T/A]ATTAAAGACTTAATACGCACAGGGGGTTGGTTTGATGGGTCTGAACCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link