ddx5

Ensembl ID:
ENSDARG00000038068
ZFIN ID:
ZDB-GENE-030131-925
Description:
probable ATP-dependent RNA helicase DDX5 [Source:RefSeq peptide;Acc:NP_997777]
Human Orthologue:
DDX5
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 [Source:HGNC Symbol;Acc:2746]
Mouse Orthologue:
Ddx5
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:105037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20007 Essential Splice Site Available for shipment Available now
sa15904 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055445 Essential Splice Site 172 514 6 14
ENSDART00000055492 Essential Splice Site 172 617 6 13
ENSDART00000128338 Essential Splice Site 172 488 6 12
ENSDART00000133718 Essential Splice Site 171 217 6 6
ENSDART00000145420 Essential Splice Site 172 496 6 13

The following transcripts of ENSDARG00000038068 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 25374434)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25142619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTCTTACAATGAACATGTTTAATTGTCTTGTTTATTTTTTTTTTTTA[G/A]TGTTTGGTATTGGCTCCCACCCGTGAGTTGGCACAGCAAGTCCAGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055445 Essential Splice Site 219 514 None 14
ENSDART00000055492 Essential Splice Site 219 617 None 13
ENSDART00000128338 Essential Splice Site 219 488 None 12
ENSDART00000133718   218 217 None 6
ENSDART00000145420 Essential Splice Site 219 496 None 13

The following transcripts of ENSDARG00000038068 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 25374290)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25142475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTATGGAGGTGCTCCCAAAGGACCACAGATCAGGGATCTGGAAAGGGG[T/A]AGGAGTGGGATCAAACCTTATTTACTTTTGAANTGCTTTTAATGGTGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link