kpna2

Ensembl ID:
ENSDARG00000038066
ZFIN IDs:
ZDB-GENE-040718-22, ZDB-GENE-040718-22, ZDB-GENE-040718-22
Description:
importin subunit alpha-2 [Source:RefSeq peptide;Acc:NP_001002335]
Human Orthologues:
AC132812.1, KPNA2
Human Descriptions:
Importin subunit alpha-2-like protein [Source:UniProtKB/Swiss-Prot;Acc:A8MYJ9]
karyopherin alpha 2 (RAG cohort 1, importin alpha 1) [Source:HGNC Symbol;Acc:6395]
Mouse Orthologue:
Kpna2
Mouse Description:
karyopherin (importin) alpha 2 Gene [Source:MGI Symbol;Acc:MGI:103561]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6890 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055490 Essential Splice Site 307 525 7 11
ENSDART00000077538   None 127 None 8
ENSDART00000126596 Essential Splice Site 328 546 6 10
Genomic Location (Zv9):
Chromosome 3 (position 25473212)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25241397
KASP Assay ID:
554-4747.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCCTCGACTGGTGCAGCTACTGGCATCTGGGGAGCTGTCCATTGTGG[T/G]AAGTTGGTGGAAAGTAGTGAACTCTTGAGKTATACGTTWAAAATGGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link