si:ch211-149k23.9

Ensembl ID:
ENSDARG00000038052
ZFIN ID:
ZDB-GENE-100922-15
Human Orthologue:
AC027045.1
Human Description:
Putative germ cell-specific gene 1-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A8MUP6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28610 Essential Splice Site Mutation detected in F1 DNA During 2017
sa802 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa28610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055465 Essential Splice Site 81 246 4 8
ENSDART00000140946   4 260 1 5
Genomic Location (Zv9):
Chromosome 16 (position 15649831)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14008290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGGAACTTGCCAGGATTCGCCAAAGGCAATTAGCCAATGCAGTGCA[G/A]TACATCTGGGAGACGGGAGAAGACAAGTACACCTTCAGATATTTCCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa802
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055465 Nonsense 101 246 4 8
ENSDART00000140946 Nonsense 25 260 1 5
Genomic Location (Zv9):
Chromosome 16 (position 15649892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14008351
KASP Assay ID:
554-0707.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGGGAGAAGACAAGTACACCTTCAGATATTTCCACACAGGATTCTGG[C/T]AGTCTTGCGAAAAACATGCTGATGGTAAGAAAAAGTCTCATGAAGAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link