flr

Ensembl ID:
ENSDARG00000038024
ZFIN ID:
ZDB-GENE-070117-2066
Description:
Tetratricopeptide repeat protein 30A [Source:UniProtKB/Swiss-Prot;Acc:A7YE96]
Human Orthologues:
TTC30A, TTC30B
Human Descriptions:
tetratricopeptide repeat domain 30A [Source:HGNC Symbol;Acc:25853]
tetratricopeptide repeat domain 30B [Source:HGNC Symbol;Acc:26425]
Mouse Orthologues:
Ttc30a1, Ttc30a2, Ttc30b
Mouse Descriptions:
tetratricopeptide repeat domain 30A1 Gene [Source:MGI Symbol;Acc:MGI:1926052]
tetratricopeptide repeat domain 30A2 Gene [Source:MGI Symbol;Acc:MGI:3700200]
tetratricopeptide repeat domain 30B Gene [Source:MGI Symbol;Acc:MGI:1919671]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40077 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055422 Missense 566 651 18 19
ENSDART00000108973 Nonsense 536 556 17 18
Genomic Location (Zv9):
Chromosome 3 (position 28999207)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 28717246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTATTTTCGCTTGGCATGACACTGACGTCCTGTTTTTCAGCTTGGAA[C/T]AGACACATGGTTCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link