prph2a

Ensembl ID:
ENSDARG00000038018
ZFIN ID:
ZDB-GENE-000616-8
Description:
peripherin 2a (retinal degeneration, slow) [Source:RefSeq peptide;Acc:NP_571641]
Human Orthologue:
PRPH2
Human Description:
peripherin 2 (retinal degeneration, slow) [Source:HGNC Symbol;Acc:9942]
Mouse Orthologue:
Prph2
Mouse Description:
peripherin 2 Gene [Source:MGI Symbol;Acc:MGI:102791]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18634 Nonsense Available for shipment Available now
sa35349 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055415 Nonsense 85 345 1 3
Genomic Location (Zv9):
Chromosome 12 (position 36425972)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34796453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTGGCWTRTTGTCTAAATGCCTTTGGTGGCAAAGTCTGCTACGACT[C/A]GCTCGACTCCTCCAARTATGCRAAATGGAAGTCTATTATGACGCCCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055415 Nonsense 236 345 2 3
Genomic Location (Zv9):
Chromosome 12 (position 36424693)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34797732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACCCTGCATCCAACAGCAAATAACCAACAACTCAGCTCACTATAGCTA[T/G]GACCACTACACCGAAGACCTAAACATCTGGAAACGAGGCTGTCGGGACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link