si:dkey-165i8.2

Ensembl ID:
ENSDARG00000038011
ZFIN IDs:
ZDB-GENE-061009-33, ZDB-GENE-090624-6
Description:
Novel protein similar to vertebrate pleckstrin homology, Sec7 and coiled-coil domains 1(Cytohesin 1)
Human Orthologue:
CYTH4
Human Description:
cytohesin 4 [Source:HGNC Symbol;Acc:9505]
Mouse Orthologue:
Cyth4
Mouse Description:
cytohesin 4 Gene [Source:MGI Symbol;Acc:MGI:2441702]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38394 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055408 Essential Splice Site 69 411 4 14
ENSDART00000141720 Essential Splice Site 22 364 1 11
Genomic Location (Zv9):
Chromosome 3 (position 29658014)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29376053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAAAACATGATGACAGAAATTCAAACAATGGAGGCCGATGATGAGAA[G/A]TGAGTATTCACCGTTATCACTCAGCTTAGTTTCCTAGCAACTAGAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055408 Nonsense 303 411 11 14
ENSDART00000141720 Nonsense 256 364 8 11
Genomic Location (Zv9):
Chromosome 3 (position 29648632)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29366671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACTTGGAAGAGGAGGTGGTTTATTCTGACTGACGGCTGCCTCTACTA[T/G]TTCCAATACACCACTGTTAGTACTCTACAGCATTTTCTATTTTTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link