rac2

Ensembl ID:
ENSDARG00000038010
ZFIN ID:
ZDB-GENE-040625-27
Description:
ras-related C3 botulinum toxin substrate 2 [Source:RefSeq peptide;Acc:NP_001002061]
Human Orthologue:
RAC2
Human Description:
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) [Source:HGNC
Mouse Orthologue:
Rac2
Mouse Description:
RAS-related C3 botulinum substrate 2 Gene [Source:MGI Symbol;Acc:MGI:97846]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31335 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055407 Essential Splice Site 12 192 2 7
ENSDART00000123619 Essential Splice Site 12 219 2 7
Genomic Location (Zv9):
Chromosome 3 (position 29677089)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29395128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCTGACAGATTACTAAGTGTTTTATCTTTGCTCTTTGTGTTTTTC[A/T]GAGCTGTGGGAAAGACCTGTCTTCTCATCAGCTACACTACCAATGCGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link