osr2

Ensembl ID:
ENSDARG00000038006
ZFIN ID:
ZDB-GENE-050417-183
Description:
Protein odd-skipped-related 2 [Source:UniProtKB/Swiss-Prot;Acc:Q567J8]
Human Orthologue:
OSR2
Human Description:
odd-skipped related 2 (Drosophila) [Source:HGNC Symbol;Acc:15830]
Mouse Orthologue:
Osr2
Mouse Description:
odd-skipped related 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1930813]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22965 Nonsense Mutation detected in F1 DNA During 2014
sa10900 Nonsense Available for shipment Available now
sa19156 Nonsense Mutation detected in F1 DNA During 2014
sa2881 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055395 Nonsense 46 238 2 4
Genomic Location:
Chromosome 16 (position 58052695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGGTGGCGGTGGATCAGCTGTACGGCCTCAGCGCGCTCCACACCGTG[C/T]AGATGAACCGGTGGACGGTGGGCTTCCCGCAGCTGCAGGGCCTGGCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055395 Nonsense 147 238 2 4
ENSDART00000055395 Nonsense 147 238 2 4
ENSDART00000055395 Nonsense 147 238 2 4
Genomic Location:
Chromosome 16 (position 58052390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGGAGTTCATCTGCCGGTTCTGCGGGAGACACTTCACCAAATCCTA[C/A]AACCTGCTGATCCACGAGCGCACACACACCGACGAGCGGCCCTACACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055395 Nonsense 147 238 2 4
ENSDART00000055395 Nonsense 147 238 2 4
ENSDART00000055395 Nonsense 147 238 2 4
Genomic Location:
Chromosome 16 (position 58052390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGGAGTTCATCTGCCGGTTCTGCGGGAGACACTTCACCAAATCCTA[C/A]AACCTGCTGATCCACGAGCGCACACACACCGACGAGCGGCCCTACACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055395 Nonsense 147 238 2 4
ENSDART00000055395 Nonsense 147 238 2 4
ENSDART00000055395 Nonsense 147 238 2 4
Genomic Location:
Chromosome 16 (position 58052390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGGAGTTCATCTGCCGGTTCTGCGGGAGACACTTCACCAAATCCTA[C/A]AACCTGCTGATCCACGAGCGCACACACACCGACGAGCGGCCCTACACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fjxzmeeh