med25

Ensembl ID:
ENSDARG00000038005
ZFIN ID:
ZDB-GENE-040426-2850
Description:
Mediator of RNA polymerase II transcription subunit 25 [Source:UniProtKB/Swiss-Prot;Acc:Q6PEH8]
Human Orthologues:
MED25, PTOV1
Human Descriptions:
mediator complex subunit 25 [Source:HGNC Symbol;Acc:28845]
prostate tumor overexpressed 1 [Source:HGNC Symbol;Acc:9632]
Mouse Orthologues:
Med25, Ptov1
Mouse Descriptions:
mediator of RNA polymerase II transcription, subunit 25 homolog (yeast) Gene [Source:MGI Symbol;Acc:
prostate tumor over expressed gene 1 Gene [Source:MGI Symbol;Acc:MGI:1933946]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33195 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055393 Essential Splice Site 173 701 7 19
Genomic Location (Zv9):
Chromosome 3 (position 30632688)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30350727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGGGCACCGTGGAGGTTAAAGGACTTTTATGTTTGTTCTGTTTTGC[A/G]GCGGGGGATTCATTTTTCTGTAATTGCCCCACGGAAACTTCCGGCACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link