dvr1

Ensembl ID:
ENSDARG00000037995
ZFIN ID:
ZDB-GENE-980526-389
Description:
Protein DVR-1 [Source:UniProtKB/Swiss-Prot;Acc:P35621]
Human Orthologues:
GDF1, GDF3
Human Descriptions:
growth differentiation factor 1 [Source:HGNC Symbol;Acc:4214]
growth differentiation factor 3 [Source:HGNC Symbol;Acc:4218]
Mouse Orthologues:
Gdf1, Gdf3
Mouse Descriptions:
growth differentiation factor 1 Gene [Source:MGI Symbol;Acc:MGI:95683]
growth differentiation factor 3 Gene [Source:MGI Symbol;Acc:MGI:95686]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055379 Nonsense 39 355 1 2
Genomic Location (Zv9):
Chromosome 17 (position 4022555)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4086778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTCTTGTGCAAGAAAAGCTGTTTTTGAGCTCTATGGGACTCTGGAGT[C/T]GACCCAAACCATCGCATCATGCCGCAGTGCCATCACAGATGTGGAAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link