ENSDARG00000037978

Ensembl ID:
ENSDARG00000037978

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076786 Nonsense 47 207 1 5
Genomic Location (Zv9):
Chromosome 3 (position 31329256)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31047295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCGGCTTCTCAGCGTGGGCTCTGCCTTCAACTAACATCAAGATCACA[C/T]AAGGTGAGTGCCACCAGAGACAAAGACTAGGACACAACGCAGACACAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link