fus

Ensembl ID:
ENSDARG00000037968
ZFIN ID:
ZDB-GENE-040426-1010
Description:
RNA-binding protein FUS [Source:RefSeq peptide;Acc:NP_957377]
Human Orthologue:
FUS
Human Description:
fused in sarcoma [Source:HGNC Symbol;Acc:4010]
Mouse Orthologue:
Fus
Mouse Description:
fusion, derived from t(12;16) malignant liposarcoma (human) Gene [Source:MGI Symbol;Acc:MGI:1353633]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15506 Nonsense Available for shipment Available now
sa33220 Nonsense Mutation detected in F1 DNA During 2016
sa40098 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055340 Nonsense 52 541 3 15
ENSDART00000075244 Nonsense 52 237 3 9

The following transcripts of ENSDARG00000037968 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 32837760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCTATGGAGGATACAACCAARGCTCAGAGAGCAGCTCCGCTCCTTA[T/A]AATCAGGGAGGATACAGCTCCAACTATGGACAGTCCCAGTCAGGTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055340 Nonsense 140 541 5 15
ENSDART00000075244   None 237 None 9

The following transcripts of ENSDARG00000037968 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 32839432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTATAGCAGCAGCTCTCAGTCGTCTGGCTACGGTCAGCAGCAGCAG[C/T]AGAGTGGAGGTGGGTATGGAGGCAGTGGTGGTCAGTCTGGAGGATATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055340 Essential Splice Site 326 541 None 15
ENSDART00000075244   None 237 None 9

The following transcripts of ENSDARG00000037968 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 32845088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTGGACTCTGTTGCAGACTACTTTAAACAGATCGGCATCATCAAGG[T/G]AAAGTGGCAAGGCAAAAAAAAAAACACAGTGATGTGGATGACTCATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link