psmb7

Ensembl ID:
ENSDARG00000037962
ZFIN ID:
ZDB-GENE-001208-4
Description:
proteasome subunit beta type-7 [Source:RefSeq peptide;Acc:NP_001039029]
Human Orthologue:
PSMB7
Human Description:
proteasome (prosome, macropain) subunit, beta type, 7 [Source:HGNC Symbol;Acc:9544]
Mouse Orthologue:
Psmb7
Mouse Description:
proteasome (prosome, macropain) subunit, beta type 7 Gene [Source:MGI Symbol;Acc:MGI:107637]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23856 Nonsense Available for shipment Available now
sa29521 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055325 Nonsense 118 286 4 9
ENSDART00000129749 Nonsense 118 277 4 8
ENSDART00000133804 Nonsense 52 211 3 7

The following transcripts of ENSDARG00000037962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 7844246)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8251797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTCCTCCAACCTGGAGCTTCATTCTCTGTCCACCGGTCGTCTGCCA[C/T]GAGTCGCCACAGCAAACCGCATGCTCAAACAGATGCTCTTCAGGTGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055325 Nonsense 133 286 5 9
ENSDART00000129749 Nonsense 133 277 5 8
ENSDART00000133804 Nonsense 67 211 4 7

The following transcripts of ENSDARG00000037962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 7846005)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8253556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAATATGTATTATTGATGAGTCTACCATGTGTTCATGTATGCAGGTA[T/A]CAGGGTTACATCGGTGCTGCATTAGTTCTTGGAGGTGTCGATTGCACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link