rcn3

Ensembl ID:
ENSDARG00000037961
ZFIN ID:
ZDB-GENE-040625-175
Description:
reticulocalbin-3 [Source:RefSeq peptide;Acc:NP_001002158]
Human Orthologue:
RCN3
Human Description:
reticulocalbin 3, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:21145]
Mouse Orthologue:
Rcn3
Mouse Description:
reticulocalbin 3, EF-hand calcium binding domain Gene [Source:MGI Symbol;Acc:MGI:1277122]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15966 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055324 Essential Splice Site 136 316 3 8
Genomic Location:
Chromosome 3 (position 32677087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATCGGATGGATTGAGTACAAGAACACCACCTATGGATATTATATAG[G/A]TAATGAGGCTTTGCGTTTAGGCGTGGSAGCTGGTRATGTTTAATGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zizk6ch6