lrrc17

Ensembl ID:
ENSDARG00000037960
ZFIN ID:
ZDB-GENE-030131-9774
Description:
leucine-rich repeat-containing protein 17 [Source:RefSeq peptide;Acc:NP_991102]
Human Orthologue:
LRRC17
Human Description:
leucine rich repeat containing 17 [Source:HGNC Symbol;Acc:16895]
Mouse Orthologue:
Lrrc17
Mouse Description:
leucine rich repeat containing 17 Gene [Source:MGI Symbol;Acc:MGI:1921761]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa40
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055317 Nonsense 193 435 2 4
Genomic Location:
Chromosome 4 (position 19085593)
KASP Assay ID:
554-0063.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATGCACGCTGTGCAGAGCCTAGGGAATTCTCAGGGAGGCAACTGAAG[A/T]AGCTGGATGCAGAGATGCTTTGCTCCCCTGAGCAGGAGAAAGAAGCAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ril1uqvm