nosip

Ensembl ID:
ENSDARG00000037958
ZFIN ID:
ZDB-GENE-041114-146
Description:
Nitric oxide synthase-interacting protein [Source:UniProtKB/Swiss-Prot;Acc:Q5U3S7]
Human Orthologue:
NOSIP
Human Description:
nitric oxide synthase interacting protein [Source:HGNC Symbol;Acc:17946]
Mouse Orthologue:
Nosip
Mouse Description:
nitric oxide synthase interacting protein Gene [Source:MGI Symbol;Acc:MGI:1913644]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20052 Essential Splice Site Available for shipment Available now
sa20053 Nonsense Available for shipment Available now
sa40096 Nonsense Mutation detected in F1 DNA During 2017
sa16610 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055312 Essential Splice Site 24 304 1 9
Genomic Location (Zv9):
Chromosome 3 (position 32669968)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32401278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCGCGGGAGCCGTTTACACTTATCACGAGAAGAGGAAAGACACTGG[T/A]AAAGTATTATTTCTGTAGCCAACCATCCGTATCTGCTAATATGTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055312 Nonsense 28 304 2 9
Genomic Location (Zv9):
Chromosome 3 (position 32670084)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32401394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTAACAACATGTGCTTCTCTCGTGGTTTTTCAGCGGCTTCGGGTTA[T/A]GGGACACAGAGTGTGCGTTTGGGGAAGGATGCAATCAAAGATTTTGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055312 Nonsense 35 304 2 9
Genomic Location (Zv9):
Chromosome 3 (position 32670104)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32401414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCGTGGTTTTTCAGCGGCTTCGGGTTATGGGACACAGAGTGTGCGTT[T/A]GGGGAAGGATGCAATCAAAGATTTTGACTGCTGCTCTCTGTCCTTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055312 Nonsense 88 304 4 9
Genomic Location (Zv9):
Chromosome 3 (position 32671230)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32402540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCACTGTGTTAACAGATACATCTWTATGTTTTTMAATGCAGGCATA[T/A]GAAAAGCARAAACAGGCTCTGAAGAGTGAAGGCCAGCTGGAGTCCAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link