prl

Ensembl ID:
ENSDARG00000037946
ZFIN ID:
ZDB-GENE-030513-1
Description:
prolactin [Source:RefSeq peptide;Acc:NP_852102]
Human Orthologue:
PRL
Human Description:
prolactin [Source:HGNC Symbol;Acc:9445]
Mouse Orthologues:
Prl, Prl2a1, Prl2b1, Prl2c1, Prl2c2, Prl2c3, Prl2c5, Prl3a1, Prl3b1, Prl3c1, Prl3d1, Prl3d2, Prl3d3, Prl4a1, Prl5a1, Prl6a1, Prl7a1, Prl7a2, Prl7b1, Prl7c1, Prl7d1, Prl8a1, Prl8a2, Prl8a6, Prl8a8, Prl8a9
Mouse Descriptions:
prolactin family 2, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861446]
prolactin family 2, subfamily b, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861444]
Prolactin family 2, subfamily c, member 1 Gene [Source:MGI Symbol;Acc:MGI:3649927]
prolactin family 2, subfamily c, member 2 Gene [Source:MGI Symbol;Acc:MGI:97618]
prolactin family 2, subfamily c, member 3 Gene [Source:MGI Symbol;Acc:MGI:1341833]
prolactin family 2, subfamily c, member 5 Gene [Source:MGI Symbol;Acc:MGI:1858413]
prolactin family 3, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914250]
prolactin family 3, subfamily b, member 1 Gene [Source:MGI Symbol;Acc:MGI:97607]
prolactin family 3, subfamily c, member 1 Gene [Source:MGI Symbol;Acc:MGI:1351649]
prolactin family 3, subfamily d, member 1 Gene [Source:MGI Symbol;Acc:MGI:2660935]
prolactin family 3, subfamily d, member 1 Gene [Source:MGI Symbol;Acc:MGI:97606]
prolactin family 3, subfamily d, member 3 Gene [Source:MGI Symbol;Acc:MGI:2660938]
prolactin family 4, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1206587]
prolactin family 5, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:106332]
prolactin family 6, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1206579]
prolactin family 7, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1206572]
prolactin family 7, subfamily a, member 2 Gene [Source:MGI Symbol;Acc:MGI:1206571]
prolactin family 7, subfamily b, member 1 Gene [Source:MGI Symbol;Acc:MGI:1922846]
prolactin family 7, subfamily c, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914755]
prolactin family 7, subfamily d, member 1 Gene [Source:MGI Symbol;Acc:MGI:97619]
prolactin family 8, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1920494]
prolactin family 8, subfamily a, member 2 Gene [Source:MGI Symbol;Acc:MGI:894281]
prolactin family 8, subfamily a, member 6 Gene [Source:MGI Symbol;Acc:MGI:1332225]
prolactin family 8, subfamily a, member 81 Gene [Source:MGI Symbol;Acc:MGI:1921438]
prolactin family8, subfamily a, member 9 Gene [Source:MGI Symbol;Acc:MGI:1914560]
prolactin Gene [Source:MGI Symbol;Acc:MGI:97762]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6902 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26090 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055299 Essential Splice Site 11 210 1 5
Genomic Location (Zv9):
Chromosome 3 (position 32478978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32210288
KASP Assay ID:
554-4059.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAACCTGTTCTAGTAATGGCTCAAGGGTCTAGACWATACTTTGCAGG[T/C]ATCTTATCCTCAATCTAAACATTGCCTRTTTTACACTTTATGGCTATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055299 Essential Splice Site 51 210 2 5
Genomic Location (Zv9):
Chromosome 3 (position 32479232)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32210542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTTCAGACAAGCTTCACTATCTCAGCACCTCACTCACCAATGATCTG[G/A]TCAGTAAATGCATTTGTTTACTGTCTTTCGGGTCTATCGTGACTTCCGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link