lin7b

Ensembl ID:
ENSDARG00000037932
ZFIN ID:
ZDB-GENE-041011-1
Description:
protein lin-7 homolog B [Source:RefSeq peptide;Acc:NP_001018569]
Human Orthologue:
LIN7B
Human Description:
lin-7 homolog B (C. elegans) [Source:HGNC Symbol;Acc:17788]
Mouse Orthologue:
Lin7b
Mouse Description:
lin-7 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1330858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8127 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055280 None None 207 1 6
ENSDART00000055302 None None 162 1 5
ENSDART00000139644 Nonsense 6 220 1 6
ENSDART00000146509 Nonsense 6 175 1 5
Genomic Location:
Chromosome 3 (position 32071047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCGGTTCAGTCCTCCACTGCAGCAGTCTTCATGATGTCATCGTATTA[T/A]CATACGGGGAAAGAGGTGGACATGGCGGCGATGACAGAACCGCTGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zu8wt1y6