ddx42

Ensembl ID:
ENSDARG00000037928
ZFIN ID:
ZDB-GENE-050706-53
Description:
ATP-dependent RNA helicase DDX42 [Source:RefSeq peptide;Acc:NP_001032894]
Human Orthologue:
DDX42
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 [Source:HGNC Symbol;Acc:18676]
Mouse Orthologue:
Ddx42
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI Symbol;Acc:MGI:1919297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10438 Nonsense Available for shipment Available now
sa521 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055276 Nonsense 18 402 2 12
ENSDART00000076209 Nonsense 18 910 1 18
ENSDART00000103353 Nonsense 18 438 2 9
ENSDART00000127297 Nonsense 18 908 2 18
Genomic Location (Zv9):
Chromosome 3 (position 32029458)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31760768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACTGGAACAAGGGAGGCCCAAGTGGCAAGCGAGGGTTTGGATTTGGA[G/T]GATTCGCTCTTGCGACTGGGAAGAAAGAGGAGCCTCATCTCCCACAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055276   None 402 None 12
ENSDART00000076209   766 910 18 18
ENSDART00000103353 Essential Splice Site 330 438 8 9
ENSDART00000127297   764 908 18 18
Genomic Location (Zv9):
Chromosome 3 (position 32017689)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31748999
KASP Assay ID:
554-0351.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACCTGAGGGGCCGGACAGACCTCACCTGTCCTTCTCGCCATCATC[C/T]TCTTCCTCGTTTTCCATGCCACCGCCTCCAGCTCTCACCTCAGGCATTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link