im:7143923

Ensembl ID:
ENSDARG00000037926
ZFIN ID:
ZDB-GENE-050309-44
Human Orthologue:
CPNE8
Human Description:
copine VIII [Source:HGNC Symbol;Acc:23498]
Mouse Orthologue:
Cpne8
Mouse Description:
copine VIII Gene [Source:MGI Symbol;Acc:MGI:1914121]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24763 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44389 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055274 Essential Splice Site 187 430 9 15
ENSDART00000127507   None 145 None 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3545 (position 71651)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 73799516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACTCAGATCAATTTCACAGTGGCGATTGATTTCACAGCTTCTAACGG[T/A]GAGTGCCGTCTTCATCAGGAATTTCTGAAATGTATGCAGATGAGGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055274 Nonsense 404 430 15 15
ENSDART00000127507   None 145 None 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3545 (position 107788)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 73835563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTGGCCAAAGACGTTCTGGCTGAGATCCCAGACCAGTTCCTATCCTA[C/A]ATGAGAACCAGAGGCATCAAGCCGTCCCCTGCTCCTCCTCCGTACACCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link