rgs9

Ensembl ID:
ENSDARG00000037925
ZFIN IDs:
ZDB-GENE-060929-92, ZDB-GENE-060929-92, ZDB-GENE-060929-92, ZDB-GENE-060929-92
Description:
hypothetical protein LOC767636 [Source:RefSeq peptide;Acc:NP_001070045]
Human Orthologue:
RGS9
Human Description:
regulator of G-protein signaling 9 [Source:HGNC Symbol;Acc:10004]
Mouse Orthologue:
Rgs9
Mouse Description:
regulator of G-protein signaling 9 Gene [Source:MGI Symbol;Acc:MGI:1338824]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8135 Nonsense Mutation detected in F1 DNA During 2014
sa9502 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123630 None None 334 None 11
ENSDART00000130128 None None 334 None 12
ENSDART00000130591 Nonsense 386 480 15 17
ENSDART00000131018 Nonsense 386 418 16 17
Genomic Location:
Chromosome 3 (position 36384899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGGACAATGGGTCTTACAGTAAAGGGACTGGAGCATCCTCACCGCTA[T/G]GTGCTGGAGGCGGCACAGACTCACATCTTCATGCTCATGAAGAAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123630 None None 334 None 11
ENSDART00000130128 Essential Splice Site 229 334 11 12
ENSDART00000130591 None None 480 None 17
ENSDART00000131018 None None 418 None 17
Genomic Location:
Chromosome 3 (position 36385024)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAATA[T/G]AAYGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTNNNNNGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xnky0ss2