
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gna13b
- Ensembl ID:
- ENSDARG00000037924
- ZFIN ID:
- ZDB-GENE-030131-8277
- Description:
- guanine nucleotide binding protein, alpha 13 [Source:RefSeq peptide;Acc:NP_001013281]
- Human Orthologue:
- GNA13
- Human Description:
- guanine nucleotide binding protein (G protein), alpha 13 [Source:HGNC Symbol;Acc:4381]
- Mouse Orthologue:
- Gna13
- Mouse Description:
- guanine nucleotide binding protein, alpha 13 Gene [Source:MGI Symbol;Acc:MGI:95768]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1357 | Nonsense | Available for shipment | Available now |
sa31345 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1357
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028883 | Nonsense | 137 | 377 | 2 | 4 |
ENSDART00000147559 | Nonsense | 43 | 283 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 3 (position 36348218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36219502 GRCz11 3 36349100 - KASP Assay ID:
- 554-1271.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATCATGATGGCTTTTGACACACGGTCRACCATGGTGTCGCAAGGGATGT[T/A]GGAGACCAAATTGTTCCTGCAGTACCTGCCCTCAATYCGTGCCCTCTGGG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa31345
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028883 | Nonsense | 308 | 377 | 4 | 4 |
ENSDART00000147559 | Nonsense | 214 | 283 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 3 (position 36332325)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36203609 GRCz11 3 36333207 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGACGGACTTGCTGGAGGAGAAGGTCAAATCAGTGTCCATCCAGGACTA[T/A]TTCCCCGAGTTCACAGATGATCCATGGTGCCTGGGGGACGTGAAGAACTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: