gna13b

Ensembl ID:: ENSDARG00000037924
ZFIN ID:: ZDB-GENE-030131-8277
Description:: guanine nucleotide binding protein, alpha 13 [Source:RefSeq peptide;Acc:NP_001013281]
Human Orthologue:: GNA13
Human Description:: guanine nucleotide binding protein (G protein), alpha 13 [Source:HGNC Symbol;Acc:4381]
Mouse Orthologue:: Gna13
Mouse Description:: guanine nucleotide binding protein, alpha 13 Gene [Source:MGI Symbol;Acc:MGI:95768]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa1357	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa1357
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000028883	Nonsense	137	377	2	4
ENSDART00000147559	Nonsense	43	283	1	3

Genomic Location:

Chromosome 3 (position 36348218)

KASP Assay ID:

554-1271.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CATCATGATGGCTTTTGACACACGGTCRACCATGGTGTCGCAAGGGATGT[T/A]GGAGACCAAATTGTTCCTGCAGTACCTGCCCTCAATYCGTGCCCTCTGGG

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

OMIM

OMIM information for GNA13

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: