gna13b

Ensembl ID:
ENSDARG00000037924
ZFIN ID:
ZDB-GENE-030131-8277
Description:
guanine nucleotide binding protein, alpha 13 [Source:RefSeq peptide;Acc:NP_001013281]
Human Orthologue:
GNA13
Human Description:
guanine nucleotide binding protein (G protein), alpha 13 [Source:HGNC Symbol;Acc:4381]
Mouse Orthologue:
Gna13
Mouse Description:
guanine nucleotide binding protein, alpha 13 Gene [Source:MGI Symbol;Acc:MGI:95768]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1357 Nonsense Available for shipment Available now
sa31345 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028883 Nonsense 137 377 2 4
ENSDART00000147559 Nonsense 43 283 1 3
Genomic Location (Zv9):
Chromosome 3 (position 36348218)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36219502
KASP Assay ID:
554-1271.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCATGATGGCTTTTGACACACGGTCRACCATGGTGTCGCAAGGGATGT[T/A]GGAGACCAAATTGTTCCTGCAGTACCTGCCCTCAATYCGTGCCCTCTGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028883 Nonsense 308 377 4 4
ENSDART00000147559 Nonsense 214 283 3 3
Genomic Location (Zv9):
Chromosome 3 (position 36332325)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36203609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACGGACTTGCTGGAGGAGAAGGTCAAATCAGTGTCCATCCAGGACTA[T/A]TTCCCCGAGTTCACAGATGATCCATGGTGCCTGGGGGACGTGAAGAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link