rbbp6l

Ensembl ID:
ENSDARG00000037919
ZFIN ID:
ZDB-GENE-040930-5
Description:
retinoblastoma-binding protein 6 isoform 2 [Source:RefSeq peptide;Acc:NP_001003873]
Human Orthologue:
RBBP6
Human Description:
retinoblastoma binding protein 6 [Source:HGNC Symbol;Acc:9889]
Mouse Orthologues:
AC099701.1, AC158570.1, Gm9343, Rbbp6
Mouse Descriptions:
predicted gene 9343 Pseudogene [Source:MGI Symbol;Acc:MGI:3645198]
retinoblastoma binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:894835]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33231 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33232 Nonsense Mutation detected in F1 DNA During 2016
sa33233 Nonsense Mutation detected in F1 DNA During 2016
sa13575 Nonsense Available for shipment Available now
sa20073 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266   None 142 None 3
ENSDART00000102994 Essential Splice Site 314 1631 9 21
Genomic Location (Zv9):
Chromosome 3 (position 35500624)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35285820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGATGTATCCCCCGATGCCTTGATTGCAAACAAATTCTTGCGCCAA[G/A]TAAGATATCCTTGTTTTAATTGTTGGTTAGCACATGTCTCTAGTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266   None 142 None 3
ENSDART00000102994 Nonsense 637 1631 15 21
Genomic Location (Zv9):
Chromosome 3 (position 35502110)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCTGCACCTTTTCTATCCAAGGAGGAGTTTTATCGTCAGCAGCGT[C/T]GATTGAAGGAGGAGTAAGTAGTTATTGGGTTTTTAAGTATTGTCTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266   None 142 None 3
ENSDART00000102994 Nonsense 683 1631 17 21
Genomic Location (Zv9):
Chromosome 3 (position 35502504)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAATTACATTTTTTCCAGATCCAAATCCCCTTACAGGGGTTCCTCCTA[C/A]AGTGGTTCTTCATATTCCTATTCAAAATCTCGCTCTCGTTCCAGATCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266   None 142 None 3
ENSDART00000102994 Nonsense 778 1631 17 21
Genomic Location (Zv9):
Chromosome 3 (position 35502787)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTCGTGAGATGAGTGGGATGGTAAGTGGCATCTACCGTTCCCGCTCT[C/T]GATCCCCCATGTATAGAAATCATAGTCCTGGCAAGAAACTCCCACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266   None 142 None 3
ENSDART00000102994 Nonsense 1441 1631 21 21
Genomic Location (Zv9):
Chromosome 3 (position 35504963)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35290159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGGCAGTGACCATGGCAGTGAGCGGAGCTCCTCTTCTCAGTCTTCT[A/T]GAGACAGGCAGGCTGATAAAGCTGAACCAAACTCTAGAAAGCCAACAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link