itga3a

Ensembl ID:
ENSDARG00000037917
ZFIN ID:
ZDB-GENE-090805-3
Description:
LOC407685 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW79]
Human Orthologues:
ITGA6, ITGA7
Human Descriptions:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
integrin, alpha 7 [Source:HGNC Symbol;Acc:6143]
Mouse Orthologues:
Itga6, Itga7
Mouse Descriptions:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]
integrin alpha 7 Gene [Source:MGI Symbol;Acc:MGI:102700]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9528 Nonsense Available for shipment Available now
sa20069 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Nonsense 492 1053 11 26
Genomic Location:
Chromosome 3 (position 34972545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAATCAGTACATTTTGTTTTCTCAAACAGCATTGAAGCAAAAGTCTG[T/A]TTCTCCTACACATACAGCACTGGCACTGCCAGTTCCCAGAAGGCCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Essential Splice Site 751 1053 17 26
Genomic Location:
Chromosome 3 (position 34979211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTTCAATAGACATGCAGGAGATTGAGACAGAGCTGCAGCTCTCAACG[T/A]ATGAGAAATCACCCTGATTTACTTCAGATTCTCAAATAAGCTGCACATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/otkyyhii