itga3a

Ensembl ID:
ENSDARG00000037917
ZFIN ID:
ZDB-GENE-090805-3
Description:
LOC407685 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW79]
Human Orthologues:
ITGA6, ITGA7
Human Descriptions:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
integrin, alpha 7 [Source:HGNC Symbol;Acc:6143]
Mouse Orthologues:
Itga6, Itga7
Mouse Descriptions:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]
integrin alpha 7 Gene [Source:MGI Symbol;Acc:MGI:102700]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26106 Nonsense Mutation detected in F1 DNA During 2015
sa9528 Nonsense Available for shipment Available now
sa20069 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa26106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Nonsense 87 1053 2 26
Genomic Location:
Chromosome 3 (position 34959959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCGGAGTCTGGACTGTCAGCCAATGAGACGGGAGATGTTTACGCCTG[T/A]CCGATCTCTGCAGACTCCAAAGACTGTGCAAGACTGAACCTCATCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Nonsense 492 1053 11 26
Genomic Location:
Chromosome 3 (position 34972545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAATCAGTACATTTTGTTTTCTCAAACAGCATTGAAGCAAAAGTCTG[T/A]TTCTCCTACACATACAGCACTGGCACTGCCAGTTCCCAGAAGGCCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Essential Splice Site 751 1053 17 26
Genomic Location:
Chromosome 3 (position 34979211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTTCAATAGACATGCAGGAGATTGAGACAGAGCTGCAGCTCTCAACG[T/A]ATGAGAAATCACCCTGATTTACTTCAGATTCTCAAATAAGCTGCACATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/otkyyhii