cdk5r1a

Ensembl ID:
ENSDARG00000037916
ZFIN ID:
ZDB-GENE-080723-17
Description:
cyclin-dependent kinase 5, regulatory subunit 1a (p35) [Source:RefSeq peptide;Acc:NP_001122214]
Human Orthologue:
CDK5R1
Human Description:
cyclin-dependent kinase 5, regulatory subunit 1 (p35) [Source:HGNC Symbol;Acc:1775]
Mouse Orthologue:
Cdk5r1
Mouse Description:
cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene [Source:MGI Symbol;Acc:MGI:101764]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20068 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055262 Nonsense 236 306 1 1
Genomic Location:
Chromosome 3 (position 34907372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGAGCTGCAGGCCGAGGTGCTCACTTGCCTCTACCTGTCCTACTCCTA[C/A]ATGGGAAATGAGATTTCCTACCCGCTCAAGCCCTTCCTGGTGGAGATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1umuft5t