cacna1aa

Ensembl ID:
ENSDARG00000037905
ZFIN ID:
ZDB-GENE-040724-26
Description:
Novel protein similar to vertebrate voltage-dependent calcium channel, P/Q type, alpha 1A subunit (C
Human Orthologue:
CACNA1A
Human Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Source:HGNC Symbol;Acc:1388]
Mouse Orthologue:
Cacna1a
Mouse Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit Gene [Source:MGI Symbol;Acc:MGI:10948

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11918 Essential Splice Site Available for shipment Available now
sa20062 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8131 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8529 Nonsense Mutation detected in F1 DNA During 2014
sa20061 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25253 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 127 1863 None 41
ENSDART00000138765 Essential Splice Site 126 1939 None 43
ENSDART00000144774 Essential Splice Site 126 1938 None 43
Genomic Location:
Chromosome 3 (position 33966129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACAGCACCTTCCAGACGGGGACAAGACACCTATGTCAGAGCGTTTGG[T/C]AAGTTCAGGTCTTGTTGATCAATGTTACTTTGTTTCTAGAAGCTACATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 205 1863 4 41
ENSDART00000138765 Essential Splice Site 204 1939 4 43
ENSDART00000144774 Essential Splice Site 204 1938 4 43
Genomic Location:
Chromosome 3 (position 33942287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCTGTTCGAGTGTTGAGACCTCTCAAGCTGGTGTCTGGGATTCCCAG[T/C]AAGTGGCATATTTCTGCATTTGCTCATTCACATGCTGATGTGGTCCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 412 1863 9 41
ENSDART00000138765 Essential Splice Site 410 1939 9 43
ENSDART00000144774 Essential Splice Site 410 1938 9 43
Genomic Location:
Chromosome 3 (position 33934134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTGGCTGACGAGGACAATGACCCAGATGACCGAATGCCCTTTGATGG[T/A]ATTTACATGAACTCTTCCATCCTTCCTTCCTTTTCATCCCCCTCTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Nonsense 1129 1863 23 41
ENSDART00000138765 Nonsense 1119 1939 23 43
ENSDART00000144774 Nonsense 1119 1938 23 43
Genomic Location:
Chromosome 3 (position 33920998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCATGTTCTATGATCTTGTGTTTTAGATTTCGGAGATTGTGTCACTA[T/A]ATCGTCACACTGAGATATTTTGAGATGTGTATTCTACTGGTTATTGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 1422 1863 29 41
ENSDART00000138765 Essential Splice Site 1412 1939 29 43
ENSDART00000144774 Essential Splice Site 1412 1938 29 43
Genomic Location:
Chromosome 3 (position 33904199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCAAGGAGACAAAATGATGGAGGACTATAGCCTGGAAAAGAATGAGG[T/C]GAAGGACATATCAGATGCATGTGTTTATAAGCTTAAGACCAATCTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Nonsense 1763 1863 38 41
ENSDART00000138765 Nonsense 1750 1939 38 43
ENSDART00000144774 Nonsense 1750 1938 38 43
Genomic Location:
Chromosome 3 (position 33889389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCTCCTCCGTTAGGCCTGGGGAAGAAGTGCCCTGCACGGGTTGCCTA[C/A]AAGGTATAGGGCCTCCGAGCGGCCAGCGCTGTGTCTGTACTGTTGGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e7ni57ul