CACNA1C

Ensembl ID:
ENSDARG00000037904
Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit [Source:HGNC Symbol;Acc:1390]
Human Orthologue:
CACNA1C
Human Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit [Source:HGNC Symbol;Acc:1390]
Mouse Orthologue:
Cacna1c
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit Gene [Source:MGI Symbol;Acc:MGI:103013]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30643 Nonsense Mutation detected in F1 DNA During 2017
sa31689 Nonsense Available for shipment Available now
sa41314 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Nonsense 470 839 16 21
Genomic Location (Zv9):
Chromosome 8 (position 55571455)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53477227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATCAGTTCAGCAGTGTTACCCAGCGTCCTCTGCAGCTGCCGCTCCCA[C/T]AGAGTCAGCCACTGTCCGATGCCAGATCCTCCAACTCCAATATAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Nonsense 601 839 18 21
Genomic Location (Zv9):
Chromosome 8 (position 55569095)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53479587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCGAGACCAGGACATGTATGAGAGTGTGTGTGATGATGAAGACGAG[C/T]AGCTGATTTCCCCGCATCCCCAGCGCTCCTCAAGACGACTCCTGCGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Nonsense 824 839 21 21
Genomic Location (Zv9):
Chromosome 8 (position 55565302)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53483078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCCAAATCTACGAGATTACAGCGATGAGGAGACGGACAGTAGCAGC[C/T]GACGGGACGAGGATCTGGCCGACGAAATGATCTACGTCTCAGTGTTGTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link