nde1

Ensembl ID:
ENSDARG00000037900
ZFIN ID:
ZDB-GENE-050913-61
Description:
nuclear distribution protein nudE homolog 1 [Source:RefSeq peptide;Acc:NP_001025374]
Human Orthologue:
NDE1
Human Description:
nudE nuclear distribution gene E homolog 1 (A. nidulans) [Source:HGNC Symbol;Acc:17619]
Mouse Orthologue:
Nde1
Mouse Description:
nuclear distribution gene E homolog 1 (A nidulans) Gene [Source:MGI Symbol;Acc:MGI:1914453]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055242 Nonsense 117 336 4 9
Genomic Location (Zv9):
Chromosome 3 (position 36510808)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36538296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGCAGAGACCACAGCCATCAAGGACCAACTGCACAAGTATATCCGA[G/T]AGTTGGAGCAGTCCAATGAKGAYCTGGAAAGAGCTAAGAGGTGGKTTYAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link