ppl

Ensembl ID:
ENSDARG00000037898
ZFIN ID:
ZDB-GENE-041008-196
Description:
periplakin [Source:RefSeq peptide;Acc:NP_001131138]
Human Orthologue:
PPL
Human Description:
periplakin [Source:HGNC Symbol;Acc:9273]
Mouse Orthologue:
Ppl
Mouse Description:
periplakin Gene [Source:MGI Symbol;Acc:MGI:1194898]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25257 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33247 Nonsense Mutation detected in F1 DNA During 2017
sa17491 Nonsense Available for shipment Available now
sa20080 Nonsense Available for shipment Available now
sa16489 Nonsense Available for shipment Available now
sa16429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055241 Essential Splice Site 459 1754 12 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845   None 1076 None 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607 Essential Splice Site 263 474 6 11
Genomic Location (Zv9):
Chromosome 3 (position 36721335)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36327769
KASP Assay ID:
554-7475.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCATAATCCCTCCAACCGACCCTGAAGCTGTGGCCAGTGCTGACAA[G/A]TGGGTATTCCTCCATATCAGGATATACAGCTAGGAGAAATAAAGTGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055241 Nonsense 735 1754 18 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 57 1076 2 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
Genomic Location (Zv9):
Chromosome 3 (position 36726538)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36322566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCATCTGCAAAGAGCTAAAACAGCCTACTCCAACTACCACAATGACTA[T/G]GAAAACCTCAATAGCTGGCTTTCCCGGATACCAAACTATGAGCCACGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055241 Nonsense 852 1754 21 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 174 1076 5 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
Genomic Location (Zv9):
Chromosome 3 (position 36727912)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36321192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTGCAATTGAGGCAAAATTCACCGAAGTAAATGCTGTGAACRAGCAG[A/T]GACTGCAGAACCTAGAATTTGCCCAAAGCCTTCTTAACCAGGTAAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055241 Nonsense 1461 1754 22 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 783 1076 6 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
Genomic Location (Zv9):
Chromosome 3 (position 36729843)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36319261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCAGCAGGACCCTCAACAAGAAAAAGAGCACTCTATCCTGCGCCTT[C/T]AGGTTGAAGAGGAGAGGCACAAGCGCATGCTCTTGGAGAAAGAGTTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055241 Nonsense 1502 1754 22 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 824 1076 6 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
ENSDART00000055241 Nonsense 1502 1754 22 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 824 1076 6 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
Genomic Location (Zv9):
Chromosome 3 (position 36729966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36319138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTGAGAGAACAGAAGTGCGTRARAAAGKTGTGCGAACTGARAAAATC[C/T]AAGTTGAGCGAGATCCAGATGCTGAGATGGATAWTATCAGGCTAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055241 Nonsense 1502 1754 22 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 824 1076 6 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
ENSDART00000055241 Nonsense 1502 1754 22 22
ENSDART00000128929   None 531 None 2
ENSDART00000131845 Nonsense 824 1076 6 6
ENSDART00000136407   None 179 None 5
ENSDART00000137607   None 474 None 11
Genomic Location (Zv9):
Chromosome 3 (position 36729966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36319138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTGAGAGAACAGAAGTGCGTRARAAAGKTGTGCGAACTGARAAAATC[C/T]AAGTTGAGCGAGATCCAGATGCTGAGATGGATAWTATCAGGCTAAAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link