ezh1

Ensembl ID:
ENSDARG00000037894
ZFIN ID:
ZDB-GENE-050114-1
Description:
Enhancer of zeste 1 [Source:UniProtKB/TrEMBL;Acc:A5XBQ4]
Human Orthologue:
EZH1
Human Description:
enhancer of zeste homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3526]
Mouse Orthologue:
Ezh1
Mouse Description:
enhancer of zeste homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1097695]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5215 Nonsense Mutation detected in F1 DNA During 2014
sa14932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039170 Nonsense 43 681 1 16
ENSDART00000101965 Nonsense 43 147 2 4
ENSDART00000112583 None None 153 None 5
Genomic Location:
Chromosome 3 (position 36857097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGAGTATATGAGATTAAGACAATTGAAACGCTTCCGCAAAGCTGAA[C/T]AAGTCAAGGTATRATGTCTTTTGYATTTGCACAGTTTTCTTTGTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039170 None None 681 16 16
ENSDART00000101965 None None 147 None 4
ENSDART00000112583 Nonsense 151 153 5 5
Genomic Location:
Chromosome 3 (position 36884642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTACAGTTGTCRTGGTTAATGGTGATCACCGCATCGGAATCTTCGCTAAG[C/T]GAGCCATACAGCAAGGAGAAGAGCTCTTTTTTGATTACAGGTGGGTTTGY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zp2c9cut