ezh1

Ensembl ID:
ENSDARG00000037894
ZFIN ID:
ZDB-GENE-050114-1
Description:
Enhancer of zeste 1 [Source:UniProtKB/TrEMBL;Acc:A5XBQ4]
Human Orthologue:
EZH1
Human Description:
enhancer of zeste homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3526]
Mouse Orthologue:
Ezh1
Mouse Description:
enhancer of zeste homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1097695]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5215 Nonsense Mutation detected in F1 DNA During 2015
sa30837 Essential Splice Site Mutation detected in F1 DNA During 2015
sa14932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039170 Nonsense 43 681 1 16
ENSDART00000101965 Nonsense 43 147 2 4
ENSDART00000112583   None 153 None 5
Genomic Location:
Chromosome 3 (position 36857097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGAGTATATGAGATTAAGACAATTGAAACGCTTCCGCAAAGCTGAA[C/T]AAGTCAAGGTATRATGTCTTTTGYATTTGCACAGTTTTCTTTGTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039170 Essential Splice Site 168 681 None 16
ENSDART00000101965   None 147 4 4
ENSDART00000112583   None 153 None 5
Genomic Location:
Chromosome 3 (position 36863231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGGAAGAGCTTATTGACAATTATGATGGTGTGCATGGAGACAGAGG[T/C]GAGCAGCACAATATGTGTACATGTAAACATCACGAGAGCTGGGATGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039170   None 681 16 16
ENSDART00000101965   None 147 None 4
ENSDART00000112583 Nonsense 151 153 5 5
Genomic Location:
Chromosome 3 (position 36884642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTACAGTTGTCRTGGTTAATGGTGATCACCGCATCGGAATCTTCGCTAAG[C/T]GAGCCATACAGCAAGGAGAAGAGCTCTTTTTTGATTACAGGTGGGTTTGY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zp2c9cut