lfng

Ensembl ID:
ENSDARG00000037879
ZFIN ID:
ZDB-GENE-980605-16
Description:
Beta-1,3-N-acetylglucosaminyltransferase lunatic fringe [Source:UniProtKB/Swiss-Prot;Acc:Q8JHF2]
Human Orthologue:
LFNG
Human Description:
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:6560]
Mouse Orthologue:
Lfng
Mouse Description:
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene [Source:MGI Symbol;Acc:MGI:1095413

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11643 Nonsense Available for shipment Available now
sa721 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028673 Nonsense 20 374 1 8
ENSDART00000138280 None None 164 None 4
Genomic Location:
Chromosome 3 (position 41912453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATATCGCGGAAAAGTCGTGGTCTCTCTTGCGGGAGCCACCKTCACCTG[T/A]CTGGGGTTTCTGTTGTTTCTCTCGCAGCATCAGCGGATTCAGGCGGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028673 None None 374 None 8
ENSDART00000138280 Nonsense 31 164 1 4
Genomic Location:
Chromosome 3 (position 41916984)
KASP Assay ID:
554-0629.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCAGTGATTCACTGATGAACTTGTGTGACTCTGYTGAAAAAGCTAAC[C/T]AGGCTTTCTCTTTGTTTTCACAGACATACATCTTCACAGAYGGCGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jc2ulflo