LOC100330897

Ensembl ID:
ENSDARG00000037861
Human Orthologues:
SLC2A14, SLC2A3
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 14 [Source:HGNC Symbol;Acc:18301]
solute carrier family 2 (facilitated glucose transporter), member 3 [Source:HGNC Symbol;Acc:11007]
Mouse Orthologue:
Slc2a3
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42676 Nonsense Mutation detected in F1 DNA During 2016
sa42675 Nonsense Mutation detected in F1 DNA During 2016
sa704 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019941 Nonsense 29 538 2 12
Genomic Location (Zv9):
Chromosome 16 (position 14238043)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12596698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATTGTGCCTCATGTTCTGCGTGTCCACAGCCGTCATTGGCTCCCTG[C/T]AATTTGGCTACAACATTGGTGTCATCAACGCTCCTGATGTGGTAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019941 Nonsense 296 538 7 12
Genomic Location (Zv9):
Chromosome 16 (position 14231693)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12590348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAACTGACTGAAACAATAGTTTTTTTGTTAACTTTCCAGGTCATGTA[T/A]TACTCAACAGAGATCTTTAGAAACGCAGGCATAACTGAGCCGGTCTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019941 Essential Splice Site 387 538 10 12
Genomic Location (Zv9):
Chromosome 16 (position 14229342)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12587997
KASP Assay ID:
554-0612.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTCTCTCTCTCCTCCCAAATGATTTAAATTCCATTCATGACTAWC[A/G]GGGAATTTCAACAGTCAAAGTTCTGGCCATTCTGGCAGTGTTCGGATTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link