LOC100330897

Ensembl ID:
ENSDARG00000037861
Human Orthologues:
SLC2A14, SLC2A3
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 14 [Source:HGNC Symbol;Acc:18301]
solute carrier family 2 (facilitated glucose transporter), member 3 [Source:HGNC Symbol;Acc:11007]
Mouse Orthologue:
Slc2a3
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa704 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019941 Essential Splice Site 387 538 10 12
Genomic Location:
Chromosome 16 (position 14229342)
KASP Assay ID:
554-0612.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTCTCTCTCTCCTCCCAAATGATTTAAATTCCATTCATGACTAWC[A/G]GGGAATTTCAACAGTCAAAGTTCTGGCCATTCTGGCAGTGTTCGGATTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c6suf55z