tmem184a

Ensembl ID:
ENSDARG00000037857
ZFIN ID:
ZDB-GENE-040426-2925
Description:
transmembrane protein 184A [Source:RefSeq peptide;Acc:NP_998685]
Human Orthologue:
TMEM184A
Human Description:
transmembrane protein 184A [Source:HGNC Symbol;Acc:28797]
Mouse Orthologue:
Tmem184a
Mouse Description:
transmembrane protein 184a Gene [Source:MGI Symbol;Acc:MGI:2385897]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3327 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6044 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13648 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055154 Essential Splice Site 135 420 3 9
Genomic Location:
Chromosome 3 (position 43679358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGACCAGTATTATGTGTATTTCGACTCTGTTCGTGACTGCTATGAAGG[T/C]ACAGTAAATCTGAGCTCCTCTCTGCCCTTACATCTRCTCCTGTCCCCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055154 Essential Splice Site 278 420 8 9
Genomic Location:
Chromosome 3 (position 43669868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGGAGTCATGGGCCATTTGAAAACATTTCTTTTGTGTGTCTTTCATC[A/T]GGCATGGTTTTGGCTATTCTGGAACGCTGTGGTGTGATCCCAGAAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055154 Nonsense 281 420 8 9
Genomic Location:
Chromosome 3 (position 43669857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCCATTTRAAAAYATTTCTTTTGTGTGTCTTTYATCWGGCATGGTTT[T/A]GGCTATTCTGGAACGCTGTGGTGTGATCCCAGAAGCTCAGTTCATTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fx01zod7