tmem184a

Ensembl ID:
ENSDARG00000037857
ZFIN ID:
ZDB-GENE-040426-2925
Description:
transmembrane protein 184A [Source:RefSeq peptide;Acc:NP_998685]
Human Orthologue:
TMEM184A
Human Description:
transmembrane protein 184A [Source:HGNC Symbol;Acc:28797]
Mouse Orthologue:
Tmem184a
Mouse Description:
transmembrane protein 184a Gene [Source:MGI Symbol;Acc:MGI:2385897]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6044 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13648 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055154 Essential Splice Site 278 420 8 9
Genomic Location (Zv9):
Chromosome 3 (position 43669868)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42239612
KASP Assay ID:
554-3874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGGAGTCATGGGCCATTTGAAAACATTTCTTTTGTGTGTCTTTCATC[A/T]GGCATGGTTTTGGCTATTCTGGAACGCTGTGGTGTGATCCCAGAAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055154 Nonsense 281 420 8 9
Genomic Location (Zv9):
Chromosome 3 (position 43669857)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42239623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCCATTTRAAAAYATTTCTTTTGTGTGTCTTTYATCWGGCATGGTTT[T/A]GGCTATTCTGGAACGCTGTGGTGTGATCCCAGAAGCTCAGTTCATTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link