hm13

Ensembl ID:
ENSDARG00000037846
ZFIN ID:
ZDB-GENE-020802-3
Description:
histocompatibility 13 [Source:RefSeq peptide;Acc:NP_997737]
Human Orthologue:
HM13
Human Description:
histocompatibility (minor) 13 [Source:HGNC Symbol;Acc:16435]
Mouse Orthologue:
H13
Mouse Description:
histocompatibility 13 Gene [Source:MGI Symbol;Acc:MGI:95886]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055142 Nonsense 20 366 1 12
ENSDART00000128433 Nonsense 20 366 1 12

The following transcripts of ENSDARG00000037846 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 509380)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 480371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGCAGACCGCGCCGGCGCCCGACGGCTCAAGTAATGGGTCGGATT[T/A]GGTAAACGGGACTGCGGGCCGGTTCGTGTCCAGCGCTGAGGGTACGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link