col9a3

Ensembl ID:
ENSDARG00000037845
ZFIN ID:
ZDB-GENE-030131-9799
Description:
Sb:cb367 protein [Source:UniProtKB/TrEMBL;Acc:A9JTG2]
Human Orthologue:
COL9A3
Human Description:
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
Mouse Orthologue:
Col9a3
Mouse Description:
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16929 Essential Splice Site Available for shipment Available now
sa13060 Essential Splice Site Available for shipment Available now
sa13212 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 82 679 4 32
Genomic Location:
Chromosome 23 (position 534142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGGCRCTGCTGGAAGCCCAGGACTGCCAGGCCTGCCCGGTGTGGATG[T/C]AAGTCAACAWTGGAGGATTTTTCCCAATCTGGCAYCCTTTTAYTGTRTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 261 679 15 32
ENSDART00000055139 Essential Splice Site 261 679 15 32
Genomic Location:
Chromosome 23 (position 524008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGTTCCAGAGGAAAGCCTGGAATTGCTGGCATTATTGGGAAAACCG[T/G]GAGTRACTGCCCTTTGTTTTAAARGTTTATTCTCAAWAAGGTTTARRTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 261 679 15 32
ENSDART00000055139 Essential Splice Site 261 679 15 32
Genomic Location:
Chromosome 23 (position 524008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGTTCCAGAGGAAAGCCTGGAATTGCTGGCATTATTGGGAAAACCG[T/G]GAGTRACTGCCCTTTGTTTTAAARGTTTATTCTCAAWAAGGTTTARRTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qeex0yac