actc1b

Ensembl ID:
ENSDARG00000037840
ZFIN ID:
ZDB-GENE-000322-1
Description:
actin, alpha cardiac muscle 1 [Source:RefSeq peptide;Acc:NP_571666]
Human Orthologue:
ACTC1
Human Description:
actin, alpha, cardiac muscle 1 [Source:HGNC Symbol;Acc:143]
Mouse Orthologue:
Actc1
Mouse Description:
actin, alpha, cardiac muscle 1 Gene [Source:MGI Symbol;Acc:MGI:87905]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055136 Nonsense 5 377 2 9
Genomic Location:
Chromosome 17 (position 764459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGATTTGTCCTGCACAGACCAACCAGAAAACCAACCATGTGTGACGAC[G/T]AGGAGACTACCGCCCTTGTGTGCGACAATGGCTCTGGCTTGGTCAAGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8f8arxgc