ogfr

Ensembl ID:
ENSDARG00000037837
ZFIN ID:
ZDB-GENE-030131-377
Human Orthologue:
OGFR
Human Description:
opioid growth factor receptor [Source:HGNC Symbol;Acc:15768]
Mouse Orthologue:
Ogfr
Mouse Description:
opioid growth factor receptor Gene [Source:MGI Symbol;Acc:MGI:1919325]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16253 Essential Splice Site Available for shipment Available now
sa5017 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055134 Essential Splice Site 112 464 4 7
Genomic Location:
Chromosome 23 (position 596404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGACCGATTACAAAAGGCTGGAGAGAGTCCAYTYCTACATTCAGTGG[T/A]ATGAAACGCATCTTTAACTTTAACACCATCTTCKTTGTTGTTATCTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055134 Nonsense 298 464 7 7
Genomic Location:
Chromosome 23 (position 600545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGAACTCTGTGGTGCTGAGCGGAGAGAGCGCAGCCAATGAARACTCA[C/T]GATACAAGAGCAAAGATGGAGAAGCAGACGCCAAACACTGCAAATCCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h6dxrxo2