polr3k

Ensembl ID:
ENSDARG00000037835
ZFIN ID:
ZDB-GENE-040718-291
Description:
DNA-directed RNA polymerase III subunit RPC10 [Source:RefSeq peptide;Acc:NP_001002553]
Human Orthologue:
POLR3K
Human Description:
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa [Source:HGNC Symbol;Acc:14121]
Mouse Orthologue:
Polr3k
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide K Gene [Source:MGI Symbol;Acc:MGI:1914255]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40148 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055129 Essential Splice Site 38 108 2 3
Genomic Location (Zv9):
Chromosome 3 (position 46420220)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48429773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGACCTGATAAAAAAATAGGAAAACAAACCTGTTTATGTGCTTTAACA[G/A]GTAAACAACAGAAAGTACCCCAAACTGAAGGAGGTTGATGATGTTCTTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link