mitfb

Ensembl ID:
ENSDARG00000037833
ZFIN ID:
ZDB-GENE-010919-1
Description:
microphthalmia-associated transcription factor [Source:RefSeq peptide;Acc:NP_571922]
Human Orthologue:
MITF
Human Description:
microphthalmia-associated transcription factor [Source:HGNC Symbol;Acc:7105]
Mouse Orthologue:
Mitf
Mouse Description:
microphthalmia-associated transcription factor Gene [Source:MGI Symbol;Acc:MGI:104554]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11609 Nonsense Available for shipment Available now
sa25188 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010248 Nonsense 92 499 2 10
Genomic Location:
Chromosome 23 (position 758726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAGATCTCCATCACACACAGCCCCGCCATCAAYGTCAGCCATCCCTG[C/A]GGCCCGCCCAGCGCCGCACAGGTGCCCATGGAGGTGCTGAAGGTAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010248 Nonsense 193 499 4 10
Genomic Location:
Chromosome 23 (position 739615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCACAACAGATGGACGATGTCATTGACGACATCATTGGTTTGGAAT[C/A]AAGTTACAGTGATGACATCATGGGACTGTCGCTGGACCCCGGACTTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0btct5ad