mitfb

Ensembl ID:
ENSDARG00000037833
ZFIN ID:
ZDB-GENE-010919-1
Description:
microphthalmia-associated transcription factor [Source:RefSeq peptide;Acc:NP_571922]
Human Orthologue:
MITF
Human Description:
microphthalmia-associated transcription factor [Source:HGNC Symbol;Acc:7105]
Mouse Orthologue:
Mitf
Mouse Description:
microphthalmia-associated transcription factor Gene [Source:MGI Symbol;Acc:MGI:104554]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11609 Nonsense Available for shipment Available now
sa43899 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25188 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010248 Nonsense 92 499 2 10
Genomic Location (Zv9):
Chromosome 23 (position 758726)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 728061
KASP Assay ID:
2261-7209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAGATCTCCATCACACACAGCCCCGCCATCAAYGTCAGCCATCCCTG[C/A]GGCCCGCCCAGCGCCGCACAGGTGCCCATGGAGGTGCTGAAGGTAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010248 Essential Splice Site 180 499 3 10
Genomic Location (Zv9):
Chromosome 23 (position 740333)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 708472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAGTCCCATGGCCTTACTGACCCTCAACCCCAACTGCGAGAAAGAG[G/A]TGAGAGTGCTGACACTAGATATCTATCGCAAAATTATCGTTATCATGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010248 Nonsense 193 499 4 10
Genomic Location (Zv9):
Chromosome 23 (position 739615)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 707754
KASP Assay ID:
554-7887.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCACAACAGATGGACGATGTCATTGACGACATCATTGGTTTGGAAT[C/A]AAGTTACAGTGATGACATCATGGGACTGTCGCTGGACCCCGGACTTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link