lgals3bpa

Ensembl ID:
ENSDARG00000037805
ZFIN ID:
ZDB-GENE-060331-57
Description:
Galectin-3-binding protein A [Source:UniProtKB/Swiss-Prot;Acc:Q24JV9]
Human Orthologue:
LGALS3BP
Human Description:
lectin, galactoside-binding, soluble, 3 binding protein [Source:HGNC Symbol;Acc:6564]
Mouse Orthologue:
Lgals3bp
Mouse Description:
lectin, galactoside-binding, soluble, 3 binding protein Gene [Source:MGI Symbol;Acc:MGI:99554]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20159 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055088 Essential Splice Site 135 567 4 5
Genomic Location:
Chromosome 3 (position 58518711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATTTCTCTCACATCCACATGTTTTTTGATCCATTTTGTTTACTTTTC[A/T]GGTACAAACGCAACCAACATCCGTCAGATCTCTGTGGATAACAGTCTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bqogrd6t